Total Posts:19|Showing Posts:1-19
Jump to topic:

Genetic Mutation Increase Information?

GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/10/2015 10:39:41 PM
Posted: 1 year ago
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?
Burzmali
Posts: 1,310
Add as Friend
Challenge to a Debate
Send a Message
10/10/2015 11:07:23 PM
Posted: 1 year ago
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

What do you mean by "increase in information?"
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/10/2015 11:53:20 PM
Posted: 1 year ago
an encoded, symbolically represented message conveying expected action and intended purpose", and state that:

-Information is always present when all the following five hierarchical levels are observed in a system: statistics, syntax, semantics, pragmatics and apobetics"
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/10/2015 11:54:37 PM
Posted: 1 year ago
At 10/10/2015 11:53:20 PM, GrittyWorm wrote:
an encoded, symbolically represented message conveying expected action and intended purpose", and state that:

-Information is always present when all the following five hierarchical levels are observed in a system: statistics, syntax, semantics, pragmatics and apobetics"

Is there an example of this definition of "information" increasing?
SM2
Posts: 546
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:00:13 AM
Posted: 1 year ago
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

You mean a mutation that adds nucleotide sequences to the genome instead of deleting them?

Huntington's Disease.

The normal Huntington's gene has 26 or less CAG repeats.

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Replication errors can increase the number of CAG repeats. Too many repeats causes the abnormal Huntington's protein, and thus the disease.

35 repeats is the upper limit for normal protein expression. Individuals in the 26 - 35 range show no symptoms, but their children are at greater risk (because they're closer to the threshold, and additional mutation will push them over).

36 - 39 repeats is dangerous. Individuals may have a milder form of Huntington's disease, or may never develop the symptoms in their lifetime. Their children have a 50% chance of inheriting the disease.

40+ repeats means they will display the symptoms of Huntington's.

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Compare that with the first sequence. An additional 14 CAG repeats were added (you can count them if you want), and changed the phenotype of the individual. In this case, the addition is detrimental, but there are some proteins where addition of repeats improves their function. These mutations provide an evolutionary advantage, and usually spread through the population over many generations.
Burzmali
Posts: 1,310
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:08:08 AM
Posted: 1 year ago
At 10/10/2015 11:53:20 PM, GrittyWorm wrote:
an encoded, symbolically represented message conveying expected action and intended purpose", and state that:

-Information is always present when all the following five hierarchical levels are observed in a system: statistics, syntax, semantics, pragmatics and apobetics"

I asked what you mean, not for the dictionary definition. Do you mean a new gene? A new regulation site?
Burzmali
Posts: 1,310
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:09:04 AM
Posted: 1 year ago
At 10/11/2015 12:05:10 AM, GrittyWorm wrote:
Is there an example of a hot female woman mutating bigger, nicer, firmer breasts?

Oh, you're trolling. Pretend I never participated in this thread.
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:14:21 AM
Posted: 1 year ago
At 10/11/2015 12:09:04 AM, Burzmali wrote:
At 10/11/2015 12:05:10 AM, GrittyWorm wrote:
Is there an example of a hot female woman mutating bigger, nicer, firmer breasts?

Oh, you're trolling. Pretend I never participated in this thread.

I am not trolling. I really want to know because I think evolution is bs.
SM2
Posts: 546
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:15:00 AM
Posted: 1 year ago
At 10/11/2015 12:05:10 AM, GrittyWorm wrote:
Is there an example of a hot female woman mutating bigger, nicer, firmer breasts?

Not in your family.
UtherPenguin
Posts: 3,674
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:23:34 AM
Posted: 1 year ago
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum
"Change your sig."
~YYW
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:29:06 AM
Posted: 1 year ago
At 10/11/2015 12:23:34 AM, UtherPenguin wrote:
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum

Nope. I am applying to Urantian based religious spirituality vs. Scietific dogma and fsith based scientific theology.
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:31:58 AM
Posted: 1 year ago
At 10/11/2015 12:15:00 AM, SM2 wrote:
At 10/11/2015 12:05:10 AM, GrittyWorm wrote:
Is there an example of a hot female woman mutating bigger, nicer, firmer breasts?

Not in your family.

My ex's boobs actually did get bigger after the breakup, but it was artificial in order to get back onme. The joke was on her though because I bought my next girl a pair.
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:34:54 AM
Posted: 1 year ago
At 10/11/2015 12:09:04 AM, Burzmali wrote:
At 10/11/2015 12:05:10 AM, GrittyWorm wrote:
Is there an example of a hot female woman mutating bigger, nicer, firmer breasts?

Oh, you're trolling. Pretend I never participated in this thread.

We never see any example of a species changing species. No good information is brought forth to better the species, and the so called "first replicating molecule"? What caused that?

Magic.
UtherPenguin
Posts: 3,674
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 12:44:53 AM
Posted: 1 year ago
At 10/11/2015 12:29:06 AM, GrittyWorm wrote:
At 10/11/2015 12:23:34 AM, UtherPenguin wrote:
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum

Nope. I am applying to Urantian based religious spirituality vs. Scietific dogma and fsith based scientific theology.

It still primarily involves science.
"Change your sig."
~YYW
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 1:33:05 AM
Posted: 1 year ago
At 10/11/2015 12:44:53 AM, UtherPenguin wrote:
At 10/11/2015 12:29:06 AM, GrittyWorm wrote:
At 10/11/2015 12:23:34 AM, UtherPenguin wrote:
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum

Nope. I am applying to Urantian based religious spirituality vs. Scietific dogma and fsith based scientific theology.

It still primarily involves science.

Perhaps, but Urantians believe in aliens, science, and extraterestrial seeding. We also believe reality is a simulation and evolution is a bs concept come up with by people wishing to seem smart who are really not even sure themselves how evolution works.
UtherPenguin
Posts: 3,674
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 1:34:16 AM
Posted: 1 year ago
At 10/11/2015 1:33:05 AM, GrittyWorm wrote:
At 10/11/2015 12:44:53 AM, UtherPenguin wrote:
At 10/11/2015 12:29:06 AM, GrittyWorm wrote:
At 10/11/2015 12:23:34 AM, UtherPenguin wrote:
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum

Nope. I am applying to Urantian based religious spirituality vs. Scietific dogma and fsith based scientific theology.

It still primarily involves science.

Perhaps, but Urantians believe in aliens, science, and extraterestrial seeding. We also believe reality is a simulation and evolution is a bs concept come up with by people wishing to seem smart who are really not even sure themselves how evolution works.

It's fine so long as the topic connects to Religion in some way. If not, then the topic should be in the science forum.
"Change your sig."
~YYW
GrittyWorm
Posts: 1,566
Add as Friend
Challenge to a Debate
Send a Message
10/11/2015 1:37:30 AM
Posted: 1 year ago
At 10/11/2015 1:34:16 AM, UtherPenguin wrote:
At 10/11/2015 1:33:05 AM, GrittyWorm wrote:
At 10/11/2015 12:44:53 AM, UtherPenguin wrote:
At 10/11/2015 12:29:06 AM, GrittyWorm wrote:
At 10/11/2015 12:23:34 AM, UtherPenguin wrote:
At 10/10/2015 10:39:41 PM, GrittyWorm wrote:
Can you give a single example of a genetic mutation that results in an increase in information to the genetic evolutionary process?

This belongs in the science forum

Nope. I am applying to Urantian based religious spirituality vs. Scietific dogma and fsith based scientific theology.

It still primarily involves science.

Perhaps, but Urantians believe in aliens, science, and extraterestrial seeding. We also believe reality is a simulation and evolution is a bs concept come up with by people wishing to seem smart who are really not even sure themselves how evolution works.

It's fine so long as the topic connects to Religion in some way. If not, then the topic should be in the science forum.

Okay. I believe evolution is false because the aliens(of much higher technology and knowledge than humans) who gave us the Urantia book say evolution is a neanderthal-like idea that only a knuckle dragging fetus minded baboon would believe.