Total Posts:49|Showing Posts:1-30|Last Page
Jump to topic:

Contradiction!!!

gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 10:44:27 PM
Posted: 5 years ago
At 2/24/2011 10:40:44 PM, GodSands wrote:
http://www.debate.org...

Click on the link and read the speech bubbles. Also I've posted this before, it wasn't that popular, I wonder why?

That's because it's in the wrong forum.
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 10:53:45 PM
Posted: 5 years ago
At 2/24/2011 10:44:27 PM, gavin.ogden wrote:
At 2/24/2011 10:40:44 PM, GodSands wrote:
http://www.debate.org...

Click on the link and read the speech bubbles. Also I've posted this before, it wasn't that popular, I wonder why?

That's because it's in the wrong forum.

Where should this post belong?
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 11:00:50 PM
Posted: 5 years ago
At 2/24/2011 10:53:45 PM, GodSands wrote:
At 2/24/2011 10:44:27 PM, gavin.ogden wrote:
At 2/24/2011 10:40:44 PM, GodSands wrote:
http://www.debate.org...

Click on the link and read the speech bubbles. Also I've posted this before, it wasn't that popular, I wonder why?

That's because it's in the wrong forum.

Where should this post belong?

should>>>does

It DOES belong in religion or philosophy.
Cliff.Stamp
Posts: 2,169
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 11:24:31 PM
Posted: 5 years ago
At 2/24/2011 10:40:44 PM, GodSands wrote:
http://www.debate.org...

Click on the link and read the speech bubbles. Also I've posted this before, it wasn't that popular, I wonder why?

Because it is a well known chestnut akin to a croco-duck. Do you actually think it is a compelling argument? If you do write out the Bayes equations for both examples and you will see why it is not.
JustCallMeTarzan
Posts: 1,922
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 11:24:54 PM
Posted: 5 years ago
At 2/24/2011 10:40:44 PM, GodSands wrote:
http://www.debate.org...

Click on the link and read the speech bubbles. Also I've posted this before, it wasn't that popular, I wonder why?

Also because it's wrong.

Receiving a pattern from outer space is unusual. Finding that biomatter, which we already know spontaneously organizes in patterns - that happen to contain a lot of useless "code" - is not unusual.

If DNA is evidence that things were designed, the designer was clearly an incompetent idiot.
Ore_Ele
Posts: 25,980
Add as Friend
Challenge to a Debate
Send a Message
2/24/2011 11:42:02 PM
Posted: 5 years ago
We see signals coming from pulsar stars. So we know that signals can come from things other than aliens.
"Wanting Red Rhino Pill to have gender"
Cerebral_Narcissist
Posts: 10,806
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 1:33:06 AM
Posted: 5 years ago
Yea it's very funny, but tarzan has told you how it fails.
I am voting for Innomen because of his intelligence, common sense, humility and the fact that Juggle appears to listen to him. Any other Presidential style would have a large sub-section of the site up in arms. If I was President I would destroy the site though elitism, others would let it run riot. Innomen represents a middle way that works, neither draconian nor anarchic and that is the only way things can work. Plus he does it all without ego trips.
tvellalott
Posts: 10,864
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 3:05:01 AM
Posted: 5 years ago
The part that annoys me is "we know for certain".
"Caitlyn Jenner is an incredibly brave and stunningly beautiful woman."

Muh threads
Using mafia tactics in real-life: http://www.debate.org...
6 years of DDO: http://www.debate.org...
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:42:46 AM
Posted: 5 years ago
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer, and so in the same way if intelligent signals from space indicate intelligence. But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence? The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:57:04 AM
Posted: 5 years ago
At 2/25/2011 10:42:46 AM, GodSands wrote:
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer, and so in the same way if intelligent signals from space indicate intelligence. But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence? The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?

Wow... It's hard to describe how far off base you actually are. You are comparing apples and oranges. Biology/evolution is not limited to Earth. You consider human beings intelligent(Clearly some are more intelligent than others), but we are that way through the evolutionary process. It's really a very simple concept, man. Also, why do you describe it as an accident? This could not be further from the truth. There is a rhyme and reason we have evolved the way we have.
Cliff.Stamp
Posts: 2,169
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:58:42 AM
Posted: 5 years ago
At 2/25/2011 10:42:46 AM, GodSands wrote:

But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence?

As noted, do the math - this is a problem of science, there is a part of statistical analysis which deals exactly with this, they are the Bayes equations for conditional inference.
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:23:40 AM
Posted: 5 years ago
At 2/25/2011 10:57:04 AM, gavin.ogden wrote:
At 2/25/2011 10:42:46 AM, GodSands wrote:
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer, and so in the same way if intelligent signals from space indicate intelligence. But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence? The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?

Wow... It's hard to describe how far off base you actually are. You are comparing apples and oranges. Biology/evolution is not limited to Earth. You consider human beings intelligent(Clearly some are more intelligent than others), but we are that way through the evolutionary process. It's really a very simple concept, man. Also, why do you describe it as an accident? This could not be further from the truth. There is a rhyme and reason we have evolved the way we have.

Perhaps I am comparing apples and oranges in the sense that DNA and signals from space are different, but they both come under the same treatment when knowing or figureing out if there is an intelligence.
Cliff.Stamp
Posts: 2,169
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:34:00 AM
Posted: 5 years ago
At 2/25/2011 11:23:40 AM, GodSands wrote:

they both come under the same treatment when knowing or figureing out if there is an intelligence.

Again, no they are not, the relevant science was noted.
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:42:01 AM
Posted: 5 years ago
At 2/25/2011 11:23:40 AM, GodSands wrote:
At 2/25/2011 10:57:04 AM, gavin.ogden wrote:
At 2/25/2011 10:42:46 AM, GodSands wrote:
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer, and so in the same way if intelligent signals from space indicate intelligence. But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence? The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?

Wow... It's hard to describe how far off base you actually are. You are comparing apples and oranges. Biology/evolution is not limited to Earth. You consider human beings intelligent(Clearly some are more intelligent than others), but we are that way through the evolutionary process. It's really a very simple concept, man. Also, why do you describe it as an accident? This could not be further from the truth. There is a rhyme and reason we have evolved the way we have.

Perhaps I am comparing apples and oranges in the sense that DNA and signals from space are different, but they both come under the same treatment when knowing or figureing out if there is an intelligence.

You are completely wrong, and again, this belongs in a different forum. You should NEVER post anything the science forum again. You are 100% ignorant in the ways of every scientific field, as far as I can tell, and if you have no desire for real scientific understanding, you should see yourself out. However, if you really want to understand science, then it is as simple as picking up a book or using the same computer you are on right now to look biology, astronomy, chemistry, physics, etc. They are all interconnected, and can answer SO MANY of your questions.
JustCallMeTarzan
Posts: 1,922
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 4:44:06 PM
Posted: 5 years ago
At 2/25/2011 10:42:46 AM, GodSands wrote:
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer,

Ok... that's only because you have the preconcieved notion that there's a true pattern to DNA. Here's a little excerpt of the human code:

tgattgcagaatatacattctattcattagcacacagaacattctccaagatagaccatacgatacacca

You see a pattern there?

and so in the same way if intelligent signals from space indicate intelligence.

Please read that... if intelligent signals indicate intelligence.

But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence?

Because DNA and signals from space are fundamentally different?!?

The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

The very definition of "pattern" is such that it cannot be created by accident. People are not look for simple natural patterns like a spinning quasar. They're looking for things like the Fibonacci sequence or powers of 2 or something that is a little more complex.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?

Well no - what is "quite stupid" is to think that there is a pattern to DNA in the first place, and then to argue that the pattern that isn't there proves intelligent design.
twerj
Posts: 3
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 5:02:24 PM
Posted: 5 years ago
DNA doesn't signal a designer because biological structures reproduce and so natural selection works on them.
Signals from outer space don't reproduce. Natural selection doesn't favor any particular pattern of radio signals.
This definitely doesn't belong on any respectable science forum.
JustCallMeTarzan
Posts: 1,922
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 5:06:25 PM
Posted: 5 years ago
At 2/25/2011 5:02:24 PM, twerj wrote:
DNA doesn't signal a designer because biological structures reproduce and so natural selection works on them.
Signals from outer space don't reproduce. Natural selection doesn't favor any particular pattern of radio signals.
This definitely doesn't belong on any respectable science forum.

We'll give you a few free passes =P

You can safely assume that anything Godsands, Interrogator, or a handful of other idiots spew is complete nonsense and doesn't belong in ANY respectable forum...
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 9:12:11 PM
Posted: 5 years ago
At 2/25/2011 4:44:06 PM, JustCallMeTarzan wrote:
At 2/25/2011 10:42:46 AM, GodSands wrote:
At 2/25/2011 1:33:06 AM, Cerebral_Narcissist wrote:
Yea it's very funny, but tarzan has told you how it fails.

I am not convinced by him. DNA to me signals a designer,

Ok... that's only because you have the preconcieved notion that there's a true pattern to DNA. Here's a little excerpt of the human code:

tgattgcagaatatacattctattcattagcacacagaacattctccaagatagaccatacgatacacca

You see a pattern there?

and so in the same way if intelligent signals from space indicate intelligence.

Please read that... if intelligent signals indicate intelligence.

But if one thinks that DNA doesn't signal a designer, why should they thing signals from space indicate an intelligence?

Because DNA and signals from space are fundamentally different?!?

The signals from space could be anything, they could be a ray of rocks that so happen to make up a mathematical pattern as they cross the vast cosmos. Of only 4 numbers. Evidently as the dish seeks life it finds a pattern where the rocks seem to create a intelligent pattern of 2, 7, 9, 3 and they make that pattern 4 times. And the person operating the dish goes, "Ah! We have found an intelligent signal, there must be life trying to get our attention." But like the DNA, it's simply a pattern created by chance an accident.

The very definition of "pattern" is such that it cannot be created by accident. People are not look for simple natural patterns like a spinning quasar. They're looking for things like the Fibonacci sequence or powers of 2 or something that is a little more complex.

So to say that we expect a pattern of intelligence from space but not from biology is quite stupid. What says, "It is credible to say there is intelligence from space due to patterns, but it isn't credible to say there is intelligence which created DNA."? It's quite pick and choosy isn't it?

Well no - what is "quite stupid" is to think that there is a pattern to DNA in the first place, and then to argue that the pattern that isn't there proves intelligent design.

I see it as this, my friend, DNA is a code, a code of 4 letters, very complex indeed. Knowing that a strand of DNA is a book of information, and that book is one of billions of others. You, presuppose that we have evolved, thus this information has been altered over time to become more and more complicated. And don't say it isn't a presupposition, your lying if you say that it isn't. You base empirical evidence on the presupposition that evolution is true and thus, you think like an evolutionist would. However I am the same, at least I admit that though.

If NASA was to get a signal from space, an intelligent one, just like in the form of DNA, would you say it came about due to an amount of time like in biology or would you say it was an intelligent signal? Answer me that please, and we may just get somewhere.
Kleptin
Posts: 5,095
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 9:28:56 PM
Posted: 5 years ago
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.
: At 5/2/2010 2:43:54 PM, innomen wrote:
It isn't about finding a theory, philosophy or doctrine and thinking it's the answer, but a practical application of one's experiences that is the answer.

: At 10/28/2010 2:40:07 PM, jharry wrote: I have already been given the greatest Gift that anyone could ever hope for [Life], I would consider myself selfish if I expected anything more.
CosmicAlfonzo
Posts: 5,955
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 9:30:02 PM
Posted: 5 years ago
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

I like you
Official "High Priest of Secular Affairs and Transient Distributor of Sonic Apple Seeds relating to the Reptilian Division of Paperwork Immoliation" of The FREEDO Bureaucracy, a DDO branch of the Erisian Front, a subdivision of the Discordian Back, a Limb of the Illuminatian Cosmic Utensil Corp
Cliff.Stamp
Posts: 2,169
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:35:05 PM
Posted: 5 years ago
At 2/25/2011 9:28:56 PM, Kleptin wrote:

Similarly, DNA builds through these physical interactions with other molecules.

All of this is true, but it does not address the question contended - could the specified complexity (purpose) arise by chance. I also don't think it would be reasonable to argue it is an ignorant to say that DNA does not contain information because it is certainly common for evolutionary biologist to talk about the information in "DNA code". It becomes therefore reasonable to ask what is the origin of this information, how come you look at an arrowhead and say that is not just random forces but you look at DNA and say, yeah that is all random.
Cliff.Stamp
Posts: 2,169
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:38:41 PM
Posted: 5 years ago
At 2/25/2011 9:12:11 PM, GodSands wrote:

If NASA was to get a signal from space, an intelligent one, just like in the form of DNA, would you say it came about due to an amount of time like in biology or would you say it was an intelligent signal?

What exactly do you mean "in the form of DNA"?
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 10:58:35 PM
Posted: 5 years ago
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

And you haven't change the way you teach in the last 3 years. Whos more dumb lol?
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:04:34 PM
Posted: 5 years ago
At 2/25/2011 10:58:35 PM, GodSands wrote:
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

And you haven't change the way you teach in the last 3 years. Whos more dumb lol?

Looks like the answer is... you.
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:08:46 PM
Posted: 5 years ago
At 2/25/2011 10:38:41 PM, Cliff.Stamp wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

If NASA was to get a signal from space, an intelligent one, just like in the form of DNA, would you say it came about due to an amount of time like in biology or would you say it was an intelligent signal?

What exactly do you mean "in the form of DNA"?

Like for example; you get a signal that reads "Ahhh, look at earth, wanna go there. Hi guys, what's up? Still enjoying the basics of life with your simple minds?" Something like that. No only kidding lol. More like a series of patterns like 'AATRCAATRCAATRCAATRC...' and that goes on and on until it is as long as 2000 pages of this 'code'. When normally you would get none meanings signals like 'EOAWUBXBSXSODSCUGNDEKKSMXWBSUBCUQYEDOHJSXNHEYDEB...' and so on.
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:10:55 PM
Posted: 5 years ago
At 2/25/2011 11:04:34 PM, gavin.ogden wrote:
At 2/25/2011 10:58:35 PM, GodSands wrote:
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

And you haven't change the way you teach in the last 3 years. Whos more dumb lol?

Looks like the answer is... you.

Thanks, I think it would be better though if that question was not given an opinionated answer. Being typical isn't funny.
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:12:54 PM
Posted: 5 years ago
At 2/25/2011 11:08:46 PM, GodSands wrote:
At 2/25/2011 10:38:41 PM, Cliff.Stamp wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

If NASA was to get a signal from space, an intelligent one, just like in the form of DNA, would you say it came about due to an amount of time like in biology or would you say it was an intelligent signal?

What exactly do you mean "in the form of DNA"?

Like for example; you get a signal that reads "Ahhh, look at earth, wanna go there. Hi guys, what's up? Still enjoying the basics of life with your simple minds?" Something like that. No only kidding lol. More like a series of patterns like 'AATRCAATRCAATRCAATRC...' and that goes on and on until it is as long as 2000 pages of this 'code'. When normally you would get none meanings signals like 'EOAWUBXBSXSODSCUGNDEKKSMXWBSUBCUQYEDOHJSXNHEYDEB...' and so on.

You do realize that we understand how DNA works now, right? Oops, of course not. Like I said, you need to stay the hell out of the science forum, man. You are making a fool out of yourself.
gavin.ogden
Posts: 1,729
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:14:22 PM
Posted: 5 years ago
At 2/25/2011 11:10:55 PM, GodSands wrote:
At 2/25/2011 11:04:34 PM, gavin.ogden wrote:
At 2/25/2011 10:58:35 PM, GodSands wrote:
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

And you haven't change the way you teach in the last 3 years. Whos more dumb lol?

Looks like the answer is... you.

Thanks, I think it would be better though if that question was not given an opinionated answer. Being typical isn't funny.

It was not an opinion question. The question had a single answer, and I hit the nail on the head.
GodSands
Posts: 2,843
Add as Friend
Challenge to a Debate
Send a Message
2/25/2011 11:33:01 PM
Posted: 5 years ago
At 2/25/2011 11:14:22 PM, gavin.ogden wrote:
At 2/25/2011 11:10:55 PM, GodSands wrote:
At 2/25/2011 11:04:34 PM, gavin.ogden wrote:
At 2/25/2011 10:58:35 PM, GodSands wrote:
At 2/25/2011 9:28:56 PM, Kleptin wrote:
At 2/25/2011 9:12:11 PM, GodSands wrote:

Equivocation, equivocation, equivocation. Using analogies to compare DNA to a code or a book or a message is what poisons your mind into associating it with intelligence.

DNA itself is a physical compound. It is no different in sophistication or meaning from a rock.

If I urinated into a bottle and my urine took on the shape of the bottle, it does not get an increase in information. It is simply reacting as one chemical substance to another chemical substance in accordance with the laws of physics. Similarly, DNA builds through these physical interactions with other molecules.

The simpler the human, the simpler the way the human sees things. Unfortunately, you haven't learned to see the universe the way a scientist does, despite the fact that you play at it so frequently.

You've shown no improvement in the past 3 years you've been here.

And you haven't change the way you teach in the last 3 years. Whos more dumb lol?

Looks like the answer is... you.

Thanks, I think it would be better though if that question was not given an opinionated answer. Being typical isn't funny.

It was not an opinion question. The question had a single answer, and I hit the nail on the head.

Yeah ok. You smacked that question didn't you.