Total Posts:131|Showing Posts:1-30|Last Page
Jump to topic:

Intelligent Design for Atheists 101

GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 6:07:26 PM
Posted: 2 years ago
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)

SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.

PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Ramshutu
Posts: 4,063
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 6:30:50 PM
Posted: 2 years ago
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)


SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.


PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

Unfortunately there are three problems with this.

Firstly, and most importantly, the combination of validate letters in DNA, inordinately outstrips the number in English, by many orders of magnitude. There is only one way to write printf("hello world") and millions of ways to transpose haemoglobin.

Secondly, and this is the big thing. DNA replicates with errors. As these errors affect subsequent replication, such effects can introduce a systemic bias towards pragmatics without intelligence.

No empirically observed code with semantics, pragmatics and syntax self replicate.
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 6:47:23 PM
Posted: 2 years ago
Aside from about a thousand other objections, I'd just like to ask you one question:

How many strings of meaningful information do you think can be found in Pi?
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 6:57:26 PM
Posted: 2 years ago
At 5/31/2014 6:30:50 PM, Ramshutu wrote:
Unfortunately there are three problems with this.

There aren't any actually, as I will show you.

Firstly, and most importantly, the combination of validate letters in DNA, inordinately outstrips the number in English, by many orders of magnitude.

Are you suggesting that just because English has less characters than Russian, English has no syntax? If not, you have no point that damages my case.

There is only one way to write printf("hello world") and millions of ways to transpose haemoglobin.

Apples and oranges. You are comparing the syntax of ja<x>vascript with the pragmatics of the genetic code. This point does not damage my case.

Secondly, and this is the big thing. DNA replicates with errors.

So does English. Are you suggesting that transcribers (is that the term?) who keep typed records of Congressional Proceedings never make typos? If not, your point does not damage my case.

As these errors affect subsequent replication, such effects can introduce a systemic bias towards pragmatics without intelligence.

This is akin to mispelling of a word in English being misunderstood as something else. E.g. mispelling "I wanna tuck you in bed" as "I wanna f*** you in bed" in a text message. This point of yours establishes that information, represented by codes, can be corrupted; that words can be generated partially via random error. It does NOT establish that the code ITSELF can be generated via random error, which is what you seem to think it means.

No empirically observed code with semantics, pragmatics and syntax self replicate.

Actually yes, the genetic code can. This is a moot point though since it doesn't damage my case at all. I didn't include the qualifier "must be able to self-replicate" in my definition of code, did I? Nope.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 7:02:18 PM
Posted: 2 years ago
At 5/31/2014 6:47:23 PM, Graincruncher wrote:
Aside from about a thousand other objections, I'd just like to ask you one question:

How many strings of meaningful information do you think can be found in Pi?

I put a lot of effort into my original post. As such, I will only be replying to those challenges I deem to be made in good faith. However, I'm human and I make mistakes, so I apologize if I ignore any bona fide posts.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 7:03:37 PM
Posted: 2 years ago
At 5/31/2014 7:02:18 PM, GarretKadeDupre wrote:
At 5/31/2014 6:47:23 PM, Graincruncher wrote:
Aside from about a thousand other objections, I'd just like to ask you one question:

How many strings of meaningful information do you think can be found in Pi?

I put a lot of effort into my original post. As such, I will only be replying to those challenges I deem to be made in good faith. However, I'm human and I make mistakes, so I apologize if I ignore any bona fide posts.

That's the most pathetic dodge I've seen in a while. Which I can only assume means you know the answer.
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 7:13:16 PM
Posted: 2 years ago
At 5/31/2014 7:03:37 PM, Graincruncher wrote:
At 5/31/2014 7:02:18 PM, GarretKadeDupre wrote:
At 5/31/2014 6:47:23 PM, Graincruncher wrote:
Aside from about a thousand other objections, I'd just like to ask you one question:

How many strings of meaningful information do you think can be found in Pi?

I put a lot of effort into my original post. As such, I will only be replying to those challenges I deem to be made in good faith. However, I'm human and I make mistakes, so I apologize if I ignore any bona fide posts.

That's the most pathetic dodge I've seen in a while. Which I can only assume means you know the answer.

Did you at least try to understand the original post from my point of view? You've given me no indication that you read even half of it.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 7:22:48 PM
Posted: 2 years ago
At 5/31/2014 7:13:16 PM, GarretKadeDupre wrote:
At 5/31/2014 7:03:37 PM, Graincruncher wrote:
At 5/31/2014 7:02:18 PM, GarretKadeDupre wrote:
At 5/31/2014 6:47:23 PM, Graincruncher wrote:
Aside from about a thousand other objections, I'd just like to ask you one question:

How many strings of meaningful information do you think can be found in Pi?

I put a lot of effort into my original post. As such, I will only be replying to those challenges I deem to be made in good faith. However, I'm human and I make mistakes, so I apologize if I ignore any bona fide posts.

That's the most pathetic dodge I've seen in a while. Which I can only assume means you know the answer.

Did you at least try to understand the original post from my point of view? You've given me no indication that you read even half of it.

I fully read and understood your original post. Would you answer my simple question, please?
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 7:24:27 PM
Posted: 2 years ago
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Envisage
Posts: 3,646
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 11:31:19 PM
Posted: 2 years ago
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)


SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.


PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

I challenge you to a debate on intelligent design.

I have been meaning to get back at you for listing our evolution debate....
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
5/31/2014 11:36:16 PM
Posted: 2 years ago
At 5/31/2014 11:31:19 PM, Envisage wrote:
I challenge you to a debate on intelligent design.

I have been meaning to get back at you for listing our evolution debate....

Go ahead!
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:38:14 AM
Posted: 2 years ago
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".

I see. Is English not your first language? Allow me to rephrase:

How many segments of Pi can possibly be interpreted as having some semantic content according to some set of rules?
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:57:28 AM
Posted: 2 years ago
At 6/1/2014 4:38:14 AM, Graincruncher wrote:
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".

I see. Is English not your first language?

I see. The fields of Information Theory are new to you, which is why you aren't aware of the ambiguity of the word "information" in the context of science. Information can often refer to either Shannon Entropy (the mainstream concept) or Universal Information (generally associated with Creationism).

Allow me to rephrase:

How many segments of Pi can possibly be interpreted as having some semantic content according to some set of rules?

Theoretically, any of them.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 5:12:11 AM
Posted: 2 years ago
At 6/1/2014 4:57:28 AM, GarretKadeDupre wrote:
At 6/1/2014 4:38:14 AM, Graincruncher wrote:
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".

I see. Is English not your first language?

I see. The fields of Information Theory are new to you, which is why you aren't aware of the ambiguity of the word "information" in the context of science. Information can often refer to either Shannon Entropy (the mainstream concept) or Universal Information (generally associated with Creationism).

No, Information Theory is not new to me. Nor is being patronised by evasive berks on the internet. I'm just well aware of how obvious the meaning of my usage was in the context of "within Pi". Of course I was not referring to Universal Information, since that is a flawed concept but, more obviously, I would have specified 'Universal Information' rather than 'Information' had I meant that.

Theoretically, any of them.

And in practice?
Such
Posts: 1,110
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 6:31:42 AM
Posted: 2 years ago
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)


SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.


PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

My major argument against this is that it doesn't necessarily prove an intelligent designer, it only proves that there's a given set of rules between the three languages -- an encryption, if you will. That's not actually very profound, as it was long since known that DNA is an encryption.

So, recently, I read a thread in which a few people agreed that breaking arguments down into simple syllogisms and taking it from there can be very effective. I quite agree.

So, let's do that here:

P1: All encryptions must be intelligently designed.
P2: DNA is an encryption.
C: DNA is intelligently designed.

Ultimately, I contend P1. As the following link demonstrates, there are actually programs that can write their own code: http://en.wikipedia.org.... Whereas that does grant a degree of an organic quality to the programs that can do this, it doesn't grant intelligence to the program, although the program does, in fact, write and modify itself, to a degree.

Extrapolating on that, scientists have created computers that can literally invent their own languages, and quoted:

"For me one of the most striking experiments in AI is the brainchild of the director of the Sony lab in Paris, Luc Steels. He has created machines that can evolve their own language. A population of 20 robots are first placed one by one in front of a mirror and they begin to explore the shapes they can make using their bodies in the mirror. Each time they make a shape they create a new word to denote the shape. For example the robot might choose to name the action of putting the left arm in a horizontal position. Each robot creates its own unique language for its own actions."

http://www.theguardian.com...

Those computers are steps toward artificial intelligence, but they can yet so much as pass a Turing Test.

Accordingly, an encryption, or a given language, however derived, is not necessarily proof of intelligence, although it can serve as evidence that can help to substantiate P1, but will not substantively prove P1 on its own.
Mhykiel
Posts: 5,987
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 6:32:29 AM
Posted: 2 years ago
At 6/1/2014 5:12:11 AM, Graincruncher wrote:
At 6/1/2014 4:57:28 AM, GarretKadeDupre wrote:
At 6/1/2014 4:38:14 AM, Graincruncher wrote:
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".

I see. Is English not your first language?

I see. The fields of Information Theory are new to you, which is why you aren't aware of the ambiguity of the word "information" in the context of science. Information can often refer to either Shannon Entropy (the mainstream concept) or Universal Information (generally associated with Creationism).

No, Information Theory is not new to me. Nor is being patronised by evasive berks on the internet. I'm just well aware of how obvious the meaning of my usage was in the context of "within Pi". Of course I was not referring to Universal Information, since that is a flawed concept but, more obviously, I would have specified 'Universal Information' rather than 'Information' had I meant that.

Theoretically, any of them.

And in practice?

Things in nature tend to exhibit either a repetitive pattern or randomness. So in nature a string of chemicals will either arrange themselves in GATCGATCGATC or complete randomness AGCTGCACGAAA. The only fair way to tell is to have a large enough sample of the string to determine if any patterns exist.

Pi is infinite non repeating decimal integers. So far calculated out to 10 TRILLION places it still has not repeated. Next is to determine if it is truly random. Meaning each space a digit can hold is a fair chance 1/10. This can not be calculated yet.

Some meme has even suggested: Pi is an infinite, nonrepeating decimal -- meaning that every possible number combination exists somewhere in pi. Converted into ASCII text, somewhere in that infinite string of digits is the name of every person you will ever love, the date, time, and manner of your death, and the answers to all great questions of the universe.

But alas your question fails because pi is a measurement. It does not react with anything. The OP explains DNA is a language with 3 parts that make a language. All 3 are needed.
Such
Posts: 1,110
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 6:58:54 AM
Posted: 2 years ago
On that note, I'd like to posit my own argument for intelligent design.

My theory is this. Notice that everything intertwines quite neatly in the Universal sense. Not only in terms of life, but in terms of everything. Life is simply comprised of certain combinations of inorganic matter. It's as though life is inherent in everything, or that life is a natural result of all things; it only requires that there is a given arrangement in a certain way, such as pieces in a puzzle, or a statement phrased in such a way that its comprehensible.

Taking it a step further, I think that life manifests itself as a higher, or more complex arrangement, or form of existence, whereas those things that aren't considered "alive" are actually comparable, but much more simple arrangements that aren't complex enough to exhibit characteristics we associate with being alive.

Therefore, the more complex something is, the more alive it is.

So, my first conclusion is:

P1: Life results from a complex arrangement.
P2: Non-life results from a simple arrangement.
C: How "alive" something is, is proportionate to how "complex" its arrangement is.

So, taking this further, one can say that a planet, as a whole, can be considered an arrangement. Accordingly, a planet in its entirety can be "alive" or "dead," as can other complex celestial manifestations, and this is not conceptually foreign to scientists who study them: http://news.discovery.com....

Taking this further still, this would mean that even more complex arrangements, such as solar systems and galaxies, as also alive and can be sentient, although they're so large-scale that we could hardly detect whether they are, rendering it unfalsifiable on its own. But, taken alone with the evidence we already have regarding simplicity vs. complexity, it is certainly possible, and hasn't been proven otherwise.

Taking all this into account, although life on this planet may not be specifically designed in the way that humans understand design as we do it, through using our senses and conveyances (like minds, hands, fingers, and all other manner of things that directly correspond to us being human), perhaps we are still manifestations of greater intelligence of which we're a part, and also a result of, much like our own concepts, designs, and inventions.
Graincruncher
Posts: 2,799
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 6:59:42 AM
Posted: 2 years ago
At 6/1/2014 6:32:29 AM, Mhykiel wrote:
At 6/1/2014 5:12:11 AM, Graincruncher wrote:
At 6/1/2014 4:57:28 AM, GarretKadeDupre wrote:
At 6/1/2014 4:38:14 AM, Graincruncher wrote:
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
I fully read and understood your original post. Would you answer my simple question, please?
How many strings of meaningful information do you think can be found in Pi?

For me to answer that question I need to know your definition of "string" and your definition of "information".

I see. Is English not your first language?

I see. The fields of Information Theory are new to you, which is why you aren't aware of the ambiguity of the word "information" in the context of science. Information can often refer to either Shannon Entropy (the mainstream concept) or Universal Information (generally associated with Creationism).

No, Information Theory is not new to me. Nor is being patronised by evasive berks on the internet. I'm just well aware of how obvious the meaning of my usage was in the context of "within Pi". Of course I was not referring to Universal Information, since that is a flawed concept but, more obviously, I would have specified 'Universal Information' rather than 'Information' had I meant that.

Theoretically, any of them.

And in practice?

Things in nature tend to exhibit either a repetitive pattern or randomness. So in nature a string of chemicals will either arrange themselves in GATCGATCGATC or complete randomness AGCTGCACGAAA. The only fair way to tell is to have a large enough sample of the string to determine if any patterns exist.

Pi is infinite non repeating decimal integers. So far calculated out to 10 TRILLION places it still has not repeated. Next is to determine if it is truly random. Meaning each space a digit can hold is a fair chance 1/10. This can not be calculated yet.

Some meme has even suggested: Pi is an infinite, nonrepeating decimal -- meaning that every possible number combination exists somewhere in pi. Converted into ASCII text, somewhere in that infinite string of digits is the name of every person you will ever love, the date, time, and manner of your death, and the answers to all great questions of the universe.

But alas your question fails because pi is a measurement. It does not react with anything. The OP explains DNA is a language with 3 parts that make a language. All 3 are needed.

Well done on thoroughly missing the point: we can find usable information in Pi simply because of statistical factors. It isn't written in, it isn't purposive, it is entirely interpretational in origin. It just happens to be there and, under the right circumstances, can be interpreted as meaningful content.

This is, by the way, completely in opposition to the idea of Universal Information as presented by ID. The point is that anything that is not completely random can potentially be a medium for transmitting information. It is merely a matter of environmental interactions as to whether it does so.

Which leads me to an amusing thought. Do you know what is irreducibly complex? Disorder.
nicraM
Posts: 21
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 8:53:31 AM
Posted: 2 years ago
The fact remains,that our brain can pick up the errors and still pronounce the word properly. We can fill in the blanks, so to speak. Same with DNA, as one poster already mentioned DNA replicates all the time with errors and just fills them in with junk DNA. You can see this occur in sickle cell anemia being split off and passed through DNA to offspring.

Or, how about the "intelligent design" of the human eye?

Now, don't get me wrong and think I have an open mind. I do. I leave the possibility open to something out there that is not us. Whether they had a part in some "design" is still yet to be seen but frankly this is not a very intelligent design.
irreverent_god
Posts: 1,378
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 9:04:03 AM
Posted: 2 years ago
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)


SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.


PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

Genetic "code" is quite different from all other codes you have listed, in comparison:

1) We know the origin and evolution of all other forms of code. The origin of genetic "code" remains unknown.
2) All other code is built from individual syntax, one line at a time. Is it not equally parsimonious to assume that genetic "code," unlike all other code, simply popped into existence, all at once?
3) All other examples are of human construct, and adhere to human rules, as established PRIOR to the writing of the code. Genetic "code" does not fit this.
4) All other forms of code used in your example apply to inorganic functions. Genetic "code" does not.
5) All other forms of code used in your example have specific, human intended purposes, genetic "code" does not.

Your attempt at inductive reasoning fails, due to a lack of correlation.
Logic and Reason are the precursor to Justice.
Faith and zealotry are the precursor to Folly.
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:17:37 PM
Posted: 2 years ago
At 6/1/2014 6:32:29 AM, Mhykiel wrote:
At 6/1/2014 5:12:11 AM, Graincruncher wrote:
At 6/1/2014 4:57:28 AM, GarretKadeDupre wrote:
At 6/1/2014 4:38:14 AM, Graincruncher wrote:
At 5/31/2014 7:24:27 PM, GarretKadeDupre wrote:
At 5/31/2014 7:22:48 PM, Graincruncher wrote:
How many strings of meaningful information do you think can be found in Pi?
Theoretically, any of them.

And in practice?

Things in nature tend to exhibit either a repetitive pattern or randomness. So in nature a string of chemicals will either arrange themselves in GATCGATCGATC or complete randomness AGCTGCACGAAA. The only fair way to tell is to have a large enough sample of the string to determine if any patterns exist.

Pi is infinite non repeating decimal integers. So far calculated out to 10 TRILLION places it still has not repeated. Next is to determine if it is truly random. Meaning each space a digit can hold is a fair chance 1/10. This can not be calculated yet.

Some meme has even suggested: Pi is an infinite, nonrepeating decimal -- meaning that every possible number combination exists somewhere in pi. Converted into ASCII text, somewhere in that infinite string of digits is the name of every person you will ever love, the date, time, and manner of your death, and the answers to all great questions of the universe.

But alas your question fails because pi is a measurement. It does not react with anything. The OP explains DNA is a language with 3 parts that make a language. All 3 are needed.

Thanks for backing me up! I'd like to point out one thing, though: I'm explaining that the genetic code, not DNA (the physical molecule itself) is a code (or language, as you put it). DNA is not literally a code, because using that logic, the ink and paper of a newspaper is the English language.

Just wanted to clear that up. I understand why opponent's find it so hard to understand the argument. It's because it's so very meta. We are describing information using information!
Proof that people witnessed living dinosaurs:
http://www.debate.org...
tkubok
Posts: 5,044
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:25:56 PM
Posted: 2 years ago
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
SYNTAX! (rules)

In ENGLISH, every noun (e.g. name for a person, like "Will") must have a vowel.
You can break this rule, but it will corrupt the information (e.g. next time someone asks your name, try to pronounce "Wll" instead of "Will." They will be convinced you have a speech impediment.)

In the GENETIC CODE, every noun (e.g. name for an amino acid, like "UUU") must be composed of 3 letters.
You can break this rule, but it will corrupt the information. (e.g. "UU" won't result in the production of an amino acid.)

In ja<x>vascript, every string e.g.

function show_alert {var string1 = "Hello World!"); alert(string1);}

must be within quotes.
You can break this rule, but it will corrupt the information. (e.g. an error message will pop up and your function will abort)


SEMANTICS! (meaning)

In ENGLISH, the sequence "Will" means the person who goes by that name in the context of replying to a payed hitman who asks, "Who do I kill?"

In the GENETIC CODE, the sequence

"GUGCUGUCUCCUGCCGACAAGACCA
ACGUCAAGGCCGCCUGGGGCAAGGUU
GGCGCGCACGCUGGCGAGUAUGGUGC
GGAGGCCCUGGAGAGGAUGUUCCUGU
CCUUCCCCACCACCAAGACCUACUUCCC
GCACUUCGACCUGAGCCACGGCUCUGC
CCAGGUUAAGGGCCACGGCAAGAAGGU
GGCCGACGCGCUGACCAACGCCGUGGC
GCACGUGGACGACAUGCCCAACGCGCU
GUCCGCCCUGAGCGACCUGCACGCGCA
CAAGCUUCGGGUGGACCCGGUCAACUU
CAAGCUCCUAAGCCACUGCCUGCUGGU
GACCCUGGCCGCCCACCUCCCCGCCGAG
UUCACCCCUGCGGUGCACGCCUCCCUGG
ACAAGUUCCUGGCUUCUGUGAGCACCGU
GCUGACCUCCAAAUACCGUUAAGCUGGA
GCCUCGGUAGCAGUUCCUCCUGCCAGAU
GGGCCUCCCAACGGGCCCUCCUCCCCUCC
UUGCACCGGCCCUUCCUGGUCUUUGAAU
AAAGUCUGAGUGGGCGGC"

means the alpha subunit of hemoglobin in the context of the translation mechanism reading

"ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC" then "AUG" and beginning on the first "G".

In ja<x>vascript, the sequence string1 means "Hello World!" in the context of function test1.


PRAGMATICS! (practicality)

In ENGLISH, the intended result is the death of a person named "Will."

In the GENETIC CODE, the intended result is the production of the alpha subunit of hemoglobin.

In ja<x>vascript, the intended result is a pop-up box showing the message "Hello World!".
---------------------------------------------

And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

This seems to be an argument that could be applied to other aspects, such as Patterns or Complexity with comparison, for example, between snowflakes and man-made quilts, etc. And yet, our understanding regarding these natural phenomena, necessarily prevent these from being true.

This kind of makes this argument an argument from ignorance. We have a natural phenomena that we currently do not have an explanation for, but we see that humans can do something similar, ergo lets attribute this to intelligence, too. And yet, when this has been used in the past, they all fail miserably. The same type of logic was applied to, for example, Fairy rings, where people noted that, wow, this sort of thing of creating a circle like this can only be done by intelligence like ourselves, therefore fairys must be responsible.
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:26:48 PM
Posted: 2 years ago
At 6/1/2014 6:31:42 AM, Such wrote:
My major argument against this is that it doesn't necessarily prove an intelligent designer, it only proves that there's a given set of rules between the three languages -- an encryption, if you will.

I think you misunderstood my OP. I use the well-known, observable fact that the genetic code has traits in common with English and ja<x>vascript. This is this my EVIDENCE, not my CONCLUSION. My conclusion is an inference: that since English and ja<x>vascript were observed to originate from intelligence, the genetic code did too.

That's not actually very profound, as it was long since known that DNA is an encryption.

So, recently, I read a thread in which a few people agreed that breaking arguments down into simple syllogisms and taking it from there can be very effective. I quite agree.

So do I!

So, let's do that here:

P1: All encryptions must be intelligently designed.
P2: DNA is an encryption.
C: DNA is intelligently designed.

Ultimately, I contend P1. As the following link demonstrates, there are actually programs that can write their own code: http://en.wikipedia.org....

Congratulations, you are one of the very, very few skeptics to pose a challenge that actually attempts to address the argument without entirely missing the point!

My argument, however, is that programs that write their own code are not exceptions to this rule. For the programs originated from intelligence, and so the code they write also originated from intelligence. The only way to empirically prove my P1 wrong is the show a code arising from randomness. Showing a code originate from intelligently designed code fails, because the first code was intelligently designed IN ORDER TO produce the other code. Just because the new code had randomness involved in it's creation does not mean it originated completely from randomness. It had an intelligent aspect to it's origin.

Whereas that does grant a degree of an organic quality to the programs that can do this, it doesn't grant intelligence to the program, although the program does, in fact, write and modify itself, to a degree.

Extrapolating on that, scientists have created computers that can literally invent their own languages, and quoted:

That's the problem with this argument: the computers were designed IN ORDER TO invent their own languages. This is the intelligent aspect to their origin.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:32:53 PM
Posted: 2 years ago
At 6/1/2014 4:25:56 PM, tkubok wrote:
At 5/31/2014 6:07:26 PM, GarretKadeDupre wrote:
And that, my friends, is why it's most parsimonious to assume the genetic code has an intelligent origin: because all observed instances of systems manifesting syntax, semantics, and pragmatics originating showed that the origin was intelligence.

This seems to be an argument that could be applied to other aspects, such as Patterns or Complexity with comparison, for example, between snowflakes and man-made quilts, etc. And yet, our understanding regarding these natural phenomena, necessarily prevent these from being true.

This kind of makes this argument an argument from ignorance.

This is very frustrating. It bothers me that so many people assert it's an argument from ignorance. An argument from ignorance is only an argument from ignorance if there is no evidence to believe the conclusion. However, in this case, I provided a very lengthy argument as evidence that the conclusion is true. PLEASE do not call this an argument from ignorance. It really bothers me (lol). Using this logic, it's an argument from ignorance to assume pencils fall on to the ground from gravity on Pluto.

And yet, when this has been used in the past, they all fail miserably. The same type of logic was applied to, for example, Fairy rings, where people noted that, wow, this sort of thing of creating a circle like this can only be done by intelligence like ourselves, therefore fairys must be responsible.

This is nothing like my argument. I identified intelligence, no fairies. Do you honestly not see the difference? We have empirical evidence of intelligence. We do no have such for fairies. By empirical, I mean we saw it with our own eyes. You could theoretically argue that we didn't actually see English originated, but that would require dismissing ancient people's records as not true. Do you want to argue that? Because that would be a legitimate objection to my argument.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:39:23 PM
Posted: 2 years ago
At 6/1/2014 6:59:42 AM, Graincruncher wrote:
Well done on thoroughly missing the point: we can find usable information in Pi simply because of statistical factors.

Yes, we can find Shannon Entropy in a sequence of Pi. No, we cannot find Universal Information in it.

Your argument is akin to saying that we can find usable information in the following string:

lfjka wedf903j d2ljdl2 djoi23djkl23jd

The only way we could find usable information in this string is to determine what code it is written in. The thing is, if you identified the code it was written in, it must also be assumed to have an intelligent origin. What you don't understand is I'm not arguing that a sequence of letters like "hat" can't arise randomly. I'm arguing that the CODE, such as ENGLISH which is required for the sequence "hat" to have any meaning, cannot arise randomly.

It isn't written in, it isn't purposive, it is entirely interpretational in origin. It just happens to be there and, under the right circumstances, can be interpreted as meaningful content.

Only if the sequence can be read according to a certain code. The sequence may be random, but the code required for it to be interpreted IS NOT. This is true no matter what code you use to interpret it, real or theoretical.
Proof that people witnessed living dinosaurs:
http://www.debate.org...
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 4:45:53 PM
Posted: 2 years ago
At 6/1/2014 9:04:03 AM, irreverent_god wrote:
Genetic "code" is quite different from all other codes you have listed, in comparison:

1) We know the origin and evolution of all other forms of code. The origin of genetic "code" remains unknown.

The origin of the genetic code has not been observed, so in that's sense, it is unknown. But my argument admits this. In fact, this is a huge point of my argument: that since it is unknown, it's most reasonable to assume it had an intelligent origin, since it shares key traits with other things that, when observed to originate, ALWAYS had an intelligent origin.

2) All other code is built from individual syntax, one line at a time. Is it not equally parsimonious to assume that genetic "code," unlike all other code, simply popped into existence, all at once?

Have you ever seen any code pop into existence randomly? No? Then why in the world would the genetic code be an exception?

3) All other examples are of human construct, and adhere to human rules, as established PRIOR to the writing of the code. Genetic "code" does not fit this.

Of course the genetic code does not adhere to human rules. I never said the genetic code adhered to human rules. You are correct that the genetic code does not fit those standards. But, did I say in my argument that the genetic code adheres to rules put in place by humans? No! So I don't know what the point of this is.

4) All other forms of code used in your example apply to inorganic functions. Genetic "code" does not.

Of course the rules of ja<x>vascript don't apply to organic functions. Did I ever say they did? No! So I don't see your point.

5) All other forms of code used in your example have specific, human intended purposes, genetic "code" does not.

For the last time, did I say the genetic code had a purpose designed by a human? No!
Proof that people witnessed living dinosaurs:
http://www.debate.org...
irreverent_god
Posts: 1,378
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 5:26:36 PM
Posted: 2 years ago
At 6/1/2014 4:45:53 PM, GarretKadeDupre wrote:
At 6/1/2014 9:04:03 AM, irreverent_god wrote:
Genetic "code" is quite different from all other codes you have listed, in comparison:

1) We know the origin and evolution of all other forms of code. The origin of genetic "code" remains unknown.

The origin of the genetic code has not been observed, so in that's sense, it is unknown. But my argument admits this. In fact, this is a huge point of my argument: that since it is unknown, it's most reasonable to assume it had an intelligent origin, since it shares key traits with other things that, when observed to originate, ALWAYS had an intelligent origin.

I disagree. Since it is unknown, it is unreasonable to assume anything, at all. Given the fact that so much of the 'support' for intelligent design generally has a specific designer (Jehovah, Allah) in mind, I am extremely reticent to concede this. Neither one of the major gawds resemble anything rational, so unless the "designer" is completely nondescript, I cannot concede this point. Is it possible that it was designed? Yes. Is it every bit as possible that it came into being by fortunate circumstance? Yes. If by design, is it equally possible that earth was a "petri dish" for another race of being? Yes. From what we have before us, however, genetic research is far more trustworthy than any theistic organization, in my view.

2) All other code is built from individual syntax, one line at a time. Is it not equally parsimonious to assume that genetic "code," unlike all other code, simply popped into existence, all at once?

Have you ever seen any code pop into existence randomly? No? Then why in the world would the genetic code be an exception?

It's not proposed, as an exception. If it happened slowly, over time, natural processes seem far more likely than any currently defined gawd. I'm not opposed to intelligent design of the universe. I am, however, completely opposed to any religious attachments that may follow. No religion is worth my time.

3) All other examples are of human construct, and adhere to human rules, as established PRIOR to the writing of the code. Genetic "code" does not fit this.

Of course the genetic code does not adhere to human rules. I never said the genetic code adhered to human rules. You are correct that the genetic code does not fit those standards. But, did I say in my argument that the genetic code adheres to rules put in place by humans? No! So I don't know what the point of this is.

It is the distinction between designed genetic code, and designed code of all other known types. All the examples you gave were human, in origin. The same cannot be said, of genetic material.

4) All other forms of code used in your example apply to inorganic functions. Genetic "code" does not.

Of course the rules of ja<x>vascript don't apply to organic functions. Did I ever say they did? No! So I don't see your point.

You gave correlative examples. You want to correlate them, but you seem to be extrapolating more from the correlation than is there.

5) All other forms of code used in your example have specific, human intended purposes, genetic "code" does not.

For the last time, did I say the genetic code had a purpose designed by a human? No!

I understand what you did not say. It is the implication that gets taken too far. You spelled out, quite specifically, why you assume that genetic code implied intelligent design, for you. However, all the examples you gave were human, in origin. Since genetic code is not human, in origin, that's as far as this correlation can be taken. To imply a gawd (if that is the destination) from these correlations would not be reasonable.
Logic and Reason are the precursor to Justice.
Faith and zealotry are the precursor to Folly.
Mhykiel
Posts: 5,987
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 7:07:51 PM
Posted: 2 years ago
At 6/1/2014 4:39:23 PM, GarretKadeDupre wrote:
At 6/1/2014 6:59:42 AM, Graincruncher wrote:
Well done on thoroughly missing the point: we can find usable information in Pi simply because of statistical factors.

Yes, we can find Shannon Entropy in a sequence of Pi. No, we cannot find Universal Information in it.

Your argument is akin to saying that we can find usable information in the following string:

lfjka wedf903j d2ljdl2 djoi23djkl23jd

The only way we could find usable information in this string is to determine what code it is written in. The thing is, if you identified the code it was written in, it must also be assumed to have an intelligent origin. What you don't understand is I'm not arguing that a sequence of letters like "hat" can't arise randomly. I'm arguing that the CODE, such as ENGLISH which is required for the sequence "hat" to have any meaning, cannot arise randomly.

It isn't written in, it isn't purposive, it is entirely interpretational in origin. It just happens to be there and, under the right circumstances, can be interpreted as meaningful content.

Only if the sequence can be read according to a certain code. The sequence may be random, but the code required for it to be interpreted IS NOT. This is true no matter what code you use to interpret it, real or theoretical.

Garrette you miss one important fact. Pi is infinite and non repeating so every combination of 0-9 will eventually be found some where in it.

It is like having a room of monkey's typing away for eternity (no the age of universe but for infinite time) you will be able to find snippets of Shakespeare from out of the gibberish.

As the length of a series increases the less likely it is purposeful because , as in the case of pi, it would exhibit all information eventually in eternity.

Every bit of genetic code is used for some function. When this code is corrupted or mutated 50% will be neutral, 49.9% will be harmful, and only .1 may be beneficial. And those estimates are extremely generous because it assumes most the DNA is junk and benign to begin with.

So you can not correlate the 2.
tkubok
Posts: 5,044
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 7:12:06 PM
Posted: 2 years ago
At 6/1/2014 4:32:53 PM, GarretKadeDupre wrote:
This is very frustrating. It bothers me that so many people assert it's an argument from ignorance. An argument from ignorance is only an argument from ignorance if there is no evidence to believe the conclusion. However, in this case, I provided a very lengthy argument as evidence that the conclusion is true. PLEASE do not call this an argument from ignorance. It really bothers me (lol). Using this logic, it's an argument from ignorance to assume pencils fall on to the ground from gravity on Pluto.

Okay, well, i basically have two reasons why i call this an argument from ignorance.

Firstly, you already know my objections to inductive reasoning arguments of this sort. Youre caught in a situation where the conclusion is necessarily going to be absurd, because a valid argument along these lines, means that an argument that concludes that therefore DNA must have been created by humans, because only humans create language of this sort that includes syntax, etc. Surely you agree that such a conclusion is absurd, and yet, it logically follows and is just as valid as the argument you are trying to make.

If you remove this aspect, then all you end up with is an argument from ignorance, because you have essentially removed the comparison between syntax, semantics, etc.

Secondly, one of the presumptions that you are necessarily making is that DNA is not an example of natural, non-intelligent production of information that contains syntax, semantics, etc. Certainly, one cannot say that this is an example of Nature producing information that contains syntax, semantics, etc, but you cant say otherwise, either, because you dont have enough evidence.

And yet your argument depends on this assumption, because otherwise, we would have an example of unintelligence producing information, syntax, semantics, etc.

Part of the problem with this stems with the fact that we only have 1 example of each, i.e. we have 1 example of language and intelligence creating this, and one example of an unknown where we do not know the origins. Its not like gravity, where we have multiple evidence and multiple examples that demonstrate that, yes, gravity exists on other planets, because it exists on all objects on this planet, as well as on other planets.

This is nothing like my argument. I identified intelligence, no fairies. Do you honestly not see the difference?

Are you honestly saying that Faeries, if they do exist, are not intelligent agencies?

We have empirical evidence of intelligence. We do no have such for fairies.

It doesnt matter if we choose to call this intelligence faeries, or God. The point of this is, its still an intelligent entity.

I mean, i brought up fairy rings as an example, so i dont know why you would be so worked up about it, as clearly, faeries are intelligent, and were used as legitimate explanations for fairy rings, by people in the past. I clearly stated "this sort of thing of creating a circle like this can only be done by intelligence"

By empirical, I mean we saw it with our own eyes. You could theoretically argue that we didn't actually see English originated, but that would require dismissing ancient people's records as not true. Do you want to argue that? Because that would be a legitimate objection to my argument.

Sure. I never disputed the fact that human language comes from humans. But this is why i feel as though you utterly ignored my first paragraph that i wrote to you.

There are many things in common, between apples and tomatos. They both have a skin. They both have seeds. They both have fleshy, juicy insides. Theyre both red. Does this mean they come from the same tree? Of course not, and we realize this from the offset because there are clear differences between apples and oranges, as well as similarities. The more fundementally different they are, the less likely they would share the same tree.

The fact that you can find similarities, doesnt mean you can ignore the differences.
GarretKadeDupre
Posts: 2,023
Add as Friend
Challenge to a Debate
Send a Message
6/1/2014 8:31:28 PM
Posted: 2 years ago
At 6/1/2014 7:12:06 PM, tkubok wrote:
At 6/1/2014 4:32:53 PM, GarretKadeDupre wrote:
This is very frustrating. It bothers me that so many people assert it's an argument from ignorance. An argument from ignorance is only an argument from ignorance if there is no evidence to believe the conclusion. However, in this case, I provided a very lengthy argument as evidence that the conclusion is true. PLEASE do not call this an argument from ignorance. It really bothers me (lol). Using this logic, it's an argument from ignorance to assume pencils fall on to the ground from gravity on Pluto.

Okay, well, i basically have two reasons why i call this an argument from ignorance.

Firstly, you already know my objections to inductive reasoning arguments of this sort.

Yes, I'm aware you've brought up the fact that my logic seems to lead to the conclusion that humans designed DNA. I think you did this twice (once a long time ago).

Youre caught in a situation where the conclusion is necessarily going to be absurd, because a valid argument along these lines, means that an argument that concludes that therefore DNA must have been created by humans, because only humans create language of this sort that includes syntax, etc. Surely you agree that such a conclusion is absurd, and yet, it logically follows and is just as valid as the argument you are trying to make.

Actually all this means is that I need to stick in another premise to make my argument valid: Extra Premise: It's logically impossible for humans to have designed genetic code, since by definition, all humans are composed of genetic code. Therefore, a non-human intelligence designed the genetic code.

If you remove this aspect, then all you end up with is an argument from ignorance, because you have essentially removed the comparison between syntax, semantics, etc.

No, in now way have I changed the fact that the genetic code has syntax and semantics. Even the mainstream literature acknowledges the fact that the genetic code has these properties: http://www.ncbi.nlm.nih.gov...


Secondly, one of the presumptions that you are necessarily making is that DNA is not an example of natural, non-intelligent production of information that contains syntax, semantics, etc.

Yes, and by subscribing to the Law of Gravity, you are necessarily presuming that Gravity works whenever we aren't looking. You see how absurd your logic is? You are applying a double-standard to my hypothesis, and the laws of physics.

Certainly, one cannot say that this is an example of Nature producing information that contains syntax, semantics, etc, but you cant say otherwise, either, because you dont have enough evidence.

Actually, yes I can. My evidence: the only observed origin of "code" (a system with syntax, semantics, and pragmatics) is intelligence. Voila. How many times must I repeat myself?


And yet your argument depends on this assumption, because otherwise, we would have an example of unintelligence producing information, syntax, semantics, etc.

Part of the problem with this stems with the fact that we only have 1 example of each, i.e. we have 1 example of language and intelligence creating this,

Did you not read my first post? I explained, IN DETAIL, 2 examples: English and Jav@script. Do I need to list the other languages? There are over 2,000. Do I need to list every other computer code? There's C, C++, Game Maker Language, Machine Code, Assembly, just to name a few. Do I need to mention Morse Code and Sign Language?

And we've observed the origin of these systems. They were always intelligence.

So, where's your ONE example of nature producing a code? You only need ONE to falsify my hypothesis. But you won't provide it, because it doesn't exist.

and one example of an unknown where we do not know the origins. Its not like gravity, where we have multiple evidence and multiple examples that demonstrate that, yes, gravity exists on other planets, because it exists on all objects on this planet, as well as on other planets.



This is nothing like my argument. I identified intelligence, no fairies. Do you honestly not see the difference?

Are you honestly saying that Faeries, if they do exist, are not intelligent agencies?

No. I'm saying that we don't have empirical evidence of Faeries, which is why it's a non-sequitur to argue that Faeries designed anything. However, we do have empirical evidence of intelligence, which is why it's completely logical to suggest intelligence designed something.

We have empirical evidence of intelligence. We do no have such for fairies.

It doesnt matter if we choose to call this intelligence faeries, or God. The point of this is, its still an intelligent entity.

Yes, which is why discussing faeries is pointless and gets no-one nowhere.

I mean, i brought up fairy rings as an example, so i dont know why you would be so worked up about it, as clearly, faeries are intelligent, and were used as legitimate explanations for fairy rings, by people in the past.

The problem is, it's a non-sequitur to say specify FAERIES made fairy rings without empirical evidence that faeries exist FIRST.

I clearly stated "this sort of thing of creating a circle like this can only be done by intelligence"

By empirical, I mean we saw it with our own eyes. You could theoretically argue that we didn't actually see English originated, but that would require dismissing ancient people's records as not true. Do you want to argue that? Because that would be a legitimate objection to my argument.

Sure. I never disputed the fact that human language comes from humans. But this is why i feel as though you utterly ignored my first paragraph that i wrote to you.

How did I ignore it?

There are many things in common, between apples and tomatos. They both have a skin. They both have seeds. They both have fleshy, juicy insides. Theyre both red. Does this mean they come from the same tree?

No, because we have EMPIRICAL EVIDENCE that they do not!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

We have no such evidence for the genetic code and English.

Of course not, and we realize this from the offset because there are clear differences between apples and oranges, as well as similarities. The more fundementally different they are, the less likely they would share the same tree.

The fact that you can find similarities, doesnt mean you can ignore the differences.

I'm not ignoring the differences. In fact, I acknowledge a HUGE difference: the difference between the English language and the genetic code is that one we saw originate, the other we didn't. I'm not ignoring this difference. In fact, it's because the difference exists that I even make this argument in the first place.
Proof that people witnessed living dinosaurs:
http://www.debate.org...